Month: August 2012

Trope-a-Day: Cosmic Chess Game

Posted by

Cosmic Chess Game: Some say that this is what the assorted stable seed AIs are playing with the entirety of known space and its civilizations.  Others say that that’s just incurably paranoid.  The former respond that that’s exactly what they’d expect the pawns of the incomprehensibly ultratech star-gods to say.  The discussion rarely gets more productive from that point.

[A comment left on the original posting of this trope read:

“It is not impossible for both sides to be correct…”

That they both are, I think, is almost certain.]

At First Glance

Posted by

We met for the first time on Qechra, the world of forges.  One morning at sunrise, standing on the Bridge of Chalcedony crossing the endless outpouring of Qechra’s ocean into one of its cooling gorges – where the spray of the falling water meets the steam boiling up from the ruddy-glowing depths of the industry below, sharp with the scents of salt and sweetness and hot metal, I looked up and saw her. Pale armor of spun glass and feathered silver gleaming in the dawn; wings as golden as her hair; gliding swiftly on the rising furnace-draught from light-tower to light-tower.

Even then, I knew, and all the clangor of the machinery was not so loud as the pounding of my hearts.

– from the private reminiscences of Octë Cyprium-ith-Avalae

Trope-a-Day: Corrupt Corporate Executive

Posted by

Corrupt Corporate Executive: Extensively (albeit not completely) averted in the Empire, inasmuch as in its genuinely free market, without (a) an extensive regulatory state to buy and then use for yourself or against the competition, (b) legislators and other politicians who feel comfortable immunizing you from consequences, or (c) a legal requirement to act in a blatantly sociopathic manner, acting this way is bad for business, and therefore profoundly stupid.  (And, when it does occur, prone to bring the Market Liberty Oversight Directorate down on your head like Rods From Gods.)

Played as straight as reality permits in general, which is to say, pervasive in the corporatist Magen Corporate and the fascist Iltine Union, but substantially less common than the cliché that the generally left-leaning modern Earth media makes it seem.

Trope-a-Day: Cool Starship

Posted by

2

Cool Starship: Basically, see Cool Chair, only slightly less prevalent due to starships being more expensive.  And, in fairness, most starships are functional things.

But there are a lot of custom jobs floating around there.  But of particular note, probably, are the Celerissima-class yachts, the smallest and least practical lighthuggers ever made for meat intelligences; the God of War, as mentioned under Deus Est Machina; and Sovereign of Stars, largest of the Imperial Primes, which is basically a medium-sized palace and its grounds fitted out with life support, engines, and other spacegoing appurtenances.

I Want a Happy Ship

Posted by

happy board: A term used in starships to describe a system status board indicating all systems operating correctly.  While status lights use the same blue-crimson or blue-amber-crimson encoding as other bistate or tristate indicators, studies have shown that most sophonts respond quickly and accurately to emotional inputs, and process these particularly well when communicated by primary body language, such as facial expressions.  As such, computerized system status boards are programmed to supplement the blue color indicator for “operational/running” with a smiling or equivalent expression emoticon, hence the term.  See also sad board.

sad board: A term used in starships to describe a system status board indicating at least one system not operating correctly.  For reasons as described under happy board, which see, computerized system status boards are programmed to supplement the crimson color indicator for “fault state/stopped” with a frowning or equivalent expression emoticon, hence the term.

– Blackjacket’s Dictionary, Imperial Navy Press

Road Repair

Posted by

The flat robot hummed unheard as it ran along the rails of the sub-highway service plenum, gliding smoothly to a stop at the location of the damaged slab.  The plenum was clear; no need to move fragments out of the way before doing the replacement.

Clunk.  The pneumatic prop-ram extruded from above and below, pressing against the damaged surface slab and the ground alike, enough to take over the support of the highway and the vehicles on it while the slab was unsealed from the surrounding framework.  The robot paused momentarily, communing with the road-grid control center…

The wheelspheres of one groundcar had barely left the slab when it dropped down under the road, the prop-ram venting, only to be abruptly shoved aside by the loader, dropped into a waste hopper and replaced on the prop-ram by a clean replacement, this in turn slammed up into place by new air just in time for the wheelspheres of the freight wagon following to cross onto it.  Moments later, a hiss of active nanosealer sealed the new slab in place.

Job number HW-112-0000188 complete; no delays.  Proceeding to next job.

Settlers Wanted!

Posted by

Colonists wanted to settle on Tilain (Innia Rise).  Currently unimproved T-class world, carbon dioxide atmosphere, mean surface temperature 270K.  Partial ecopoesis in progress to mixed D-protein-lipid-D-carbohydrate ecology.

Independent/non-politan colonial corporation; not a freesoil world.  Prospective colonists or colony groups expected to purchase a minimum of one share in the colonial corporation (current price: 5,980 Accord exvals) and provide own transport costs for self and stores delivered ex-ship at Settling Down, Tilain.  Transport to lot provided.

One 5 x 5 mile homestead lot including mineral rights and basic prefab included with single colony-share purchase; further lots are available with additional share purchases.  (All shares are voting.)  Lots selected upon arrival.  Full climatological, soil and mineral surveys available.  Lots selected must be contiguous.  No space in existing urbs available.

Minimum hundred-year commitment.  Spacer certificate required.  Families and possessors of early-colony skillsets preferred.

For more details, contact: Tilain Colonial Corporation, Suite 437, Vitry Building, Third Ring 45°, Conclave Drift.

Trope-a-Day: Cool People Rebel Against Authority

Posted by

Cool People Rebel Against Authority: Played straight and inverted.  The former because, yes, being who they are and therefore ideologically predisposed that way, tyrants and slavers and democracies and other forms of unjustified authority make great villains in Imperial adventure series.

The latter because, being such a freewheeling culture with limited and mostly opt-in authorities, the local rebels against what authority there is mostly end up portrayed as a bunch of petulant whiny jerks with the Idiot Ball firmly glued into their hands.

You’re Not Cleared For This

Posted by

2

adjustment: just about any op that doesn’t fit into any more specific category.  Anything from spiking planetary water supplies to curing a pet’s sniffles.

black house: a safe house or other facility so far out-system you can’t find your primary without a gravigraph.

cauterize: to clean up evidence or problems with extreme thoroughness when you’re out of time and options.  Usually involves ambiplasma, hence the term.

collateral budget: how non-surgical your op is allowed to get; alternatively, how much splash you’re permitted to make before Questions are Asked in the Senate, and your career becomes distinctly impaired.

defaulted: an agent, source, or other asset that’s now proven not merely unuseful but opposed; heading for the most severe censure or about to be cauterized.

deniability, minor: they can know we’re looking, as long as they can’t prove it.

deniability, major: they can know someone’s looking, but they can’t know that it’s us.

deniability, complete: they can’t know anyone’s looking, so hope they’re not paying attention.

deniability, perfect: if you know you’re looking, you’re doing it wrong.

the Executive: the shadowy council of the heads of the Directorates and INI that coordinates the Empire’s intelligence and security operations.  So far as you’re concerned, see fuliginous.

friendly silence: the well-concealed self-destruct mechanism given to you to use in the event of rigorous interrogation.

from Heaven: information that’s come down from far above – where, you don’t need to and aren’t cleared to know – and which should be believed absolutely, even where it concerns future events.

fuliginous: blacker than black, i.e., so far above your clearance level you aren’t even cleared to know what its actual clearance level is.  Anything the Fifth Directorate does.

the Game: what the people in it call the intelligence/security business.  It is, but it’s one where lives, wealth, the balance of power, and occasionally major civilizations are the stakes.  Try to play well.  No pressure.

the Ghetto: Nepscia (Galith Waste), the hellhole favored for rough intelligence games because it’s so easy for people to disappear there.  Unfortunately, people also tend to disappear there for reasons that have nothing to do with whatever op they were on.

heliums: those people with that implant, the one that suppresses anything resembling sympathy or conscience, letting them do anything that needs to and shouldn’t be done.  Occasionally useful; always a sign that your op just went prompt critical.

Mother’s garden: any of the major cities on Eilan (Eilish Expanse), whose centrality and neutrality makes it the place everyone prefers to play their friendly intelligence away games.

overwatch: the member of the proxy adhoc in charge for the current op; who you take orders from, who you report to, and who will be dissecting your performance in detail at the back-briefing.

proxy adhoc: the adhocracy beneath the Executive that ops and other directives originate from; your immediate supervisors.  See also overwatch.

[redacted for reasons of state security]: standard you-are-not-cleared-for-this message.  Also, the motto of the Fifth Directorate.  Possibly.

reduce for extraction: to make it easier to extract an agent (who should be prepared for this possibility) or a source (who somehow rarely are) from hostile territory by reducing them to a vector stack/cogence core, and disposing of the body.  Or, if vector stack technology is not in use, locally, by simply decapitating them.

quieting: removal, sometimes by assassination, or by framing, discrediting, or any other reliable means.

serious censure: killing someone reinstantiably by way of sending them a strongly worded message.

(most) serious censure: killing someone non-reinstantiably by way of sending someone else a strongly worded message.

shadow source: a non-dominant personality or agent imprinted into a hostile mind, acting as a source without the conscious awareness of its host.

sniffers: sigint ships hanging around in other people’s systems, listening to passing traffic and trying not to draw attention.  Worst job in the Shadow Fleet.

source-on-a-disk: a ripped copy of an unwilling source’s mind-state.  A clean source-on-a-disk is one where the source doesn’t know that you have it.

static: an op with no purpose but to draw attention to itself, and away from anything else.

the Antique Store: the Conclave Drift, where collateral budgets are always zero, where every fifth person who passes you on the street is in the Game, and where any mistakes will be maximally embarrassing.  But you have to play there, because everyone else does.

– excerpted from Rilial’s Informal Dictionary of Intelligence and Security Terminology

Trope-a-Day: Coolest Club Ever

Posted by

Coolest Club Ever: The best known (and with, therefore, the largest Wannabe Line in the Empire) is the Aleph, on Baranithil Station; the most popular would be the Polythalience, on the Conclave Drift; the most exclusive would be the Floating Meme – wherever it turns up next; and the most infamous would have to be the Transition, on Nepscia (see: Wretched Hive).

Trope-a-Day: Cool Chair

Posted by

1

Cool Chair: It’s a civilization built by and for technophiliacs with distinct mad science inclinations.  The non-cool chairs are in a distinct minority.

Including, yes, hovering chairs, mecha chairs, heavily armed hovering and mecha chairs, chairs that can control the surrounding environment if not in fact the starship they’re mounted in – or, indeed, operations of one kind or another across a decent chunk of the galaxy, and more than a few chairs whose semiotic and memetic load is sufficient as to be practically crystallizing the atmosphere.  (Yes, the Dragon Throne really does an excellent job of impressing the Over Nine Thousand!!!! importance of its occupants on whoever’s standing in front of it.  Which is perhaps a little unfair, given how really important it is to remember not to kneel.  Ever. [see: Pose of Supplication].)

A Particularly Rotten Haystack (2)

Posted by

If I ever again have to figure out how to program a cornucopia to produce pre-damaged goods, at least I won’t be starting from scratch.

I ventured outside Sanctuary today in pursuit of what records there were of the landing points of the refugee shipments that might have included my client’s family.  As I said, there’s no data connectivity out there, and most have no use for currency, so I took goods for barter – ration bars, medicines, batteries, ammunition.  Bad move.  My disguise might have held up, but these people can spot new goods from a mile away.

Half the govgang I tried trading for information with wanted to grab me for ransom; the other half just wanted the cornucopia.  I got a head start while they were debating the issue, but – well, fortunately the prefabs they were using still recognized the default configuration codes.  No reason to change them without a local ‘net, I suppose.  I only had to kill half a dozen to get away clean.

I’ll try the next target tomorrow – with appropriately resealed, used, and battered goods, to the eye, anyway.  With luck, I won’t have to go back to that sector to find them.

– log of <trill-trill click-warble-whistle>, inquisitive, on Márch (Innia Rise)

Trope-a-Day: Pose of Supplication

Posted by

2

Pose of Supplication: Wince.  No, don’t.  Really.

Never kowtow, kneel, genuflect, otherwise grovel, or even bow deeper than, oh, 45 degrees unless you’re about to apologize in the full formal old Japanese sense of the phrase.  Keep your head up and look people in the eye, even for values of people including the Imperial Couple speaking from the Throne.

Remember always that the Imperials make something of a point about being free people, and that the runér, in particular, do not appreciate being confused for the korásan (or other rulers-not-by-unanimous-consent-of-the-citizen-shareholders).  Shows of respect are one thing.  Obeisance, on the other hand, implying submission, is an insult (because it implies that the person in question wants your submission) and not a slight one – at best, it will get you thrown out, unheard.  Especially don’t ever try this at the Court of Courts, because there it would be so great an insult as to entirely impair your chances of leaving the building alive.

(And, yes, that includes in the temples, too.  The eikones are very uninterested in your submission; they only care about your perfection.  That, and the eldrae would have no patience with gods that went around demanding all this groveling and self-abasement; much like the Vikings, they would be inclined to ask what sort of deity doesn’t want followers strong and worthy enough to stand in its presence!)

Shiftsculpture

Posted by

Opening today at the Anchalate is the final exhibition in the Empire-wide shiftsculpture competition sponsored by the Delphys Academy of the Shaping Arts and the Company of Assemblers and Free-Roaming Nanoengineers.  General admissions will begin at Waterclock-18, after the special exhibition for the Imperial Couple and the attendance of the Throne.

The focus of the exhibition are the five finalists in the competition, now acknowledged as among the best shiftsculptors in the Empire, whose entries will be judged by a panel drawn from the Academy of the Shaping Arts and aesthant members of the Polygnostic Conclave:

Anys Lién-ith-Liés offers us a vision of unity with her statue Everysoph, a marbled bust that shifts continuously and imperceptibly through a range of eigenfaces drawn from many of the species found in Imperial space, finding aesthetically pleasing transition states between them.

<Trenchant Cyan Leitmotif in E> veers into pure abstraction, with Interconnections.  An ever-changing mass of wheels, gears, motors, pistons, bearings, and other machine parts, Interconnections is forever changing its shape and make-up, while the machine entire continues to work in perfect order despite its continual change.  When questioned as to which set of interconnections his work represents – vital, ecological, financial, societal – <Trenchant Cyan Leitmotif in E> simply replies “Yes.”

Stone Garden, an unusual bionano work by the esseli artist GAAATTCCCTGTATATACGACCTT, brings a representation of evolution down to the sophont scale.  In the Stone Garden, individual bionano organisms form and discard different adaptive structures as conditions change, forming symbiotic alliances and engaging in bitter competition to best adapt to the challenges they meet and to produce the next generation best suited to continue.

Stormheight, by Samis Archés-ith-Archiel, shows us a dynamic picture of a realm similar to the battle-halls of Kalasané or Makrekken of the kaeth, depicting a battlefield upon which tiny warriors of liquid metal do battle, being struck down into the bloody morass only to rise again and fight once more, while arcs of lightning crash all about them; a searing depiction of both the horror and the glory of war.

The final piece, an ammonia-ice sculpture by the qucequql artist <ping>-cdeeca-<semiclick>, is titled Time and Chance; illustrating the flow of time and the spread of ripples from a single cause through an endlessly reshaped, endlessly reshaping tree of flowing rivulets within a pyramid of ice, sourced from a single stream falling from above onto the apex.

The ultimate winner, to be announced in one month, will receive the centurial title of Unparalleled Master from the Academy and recognition by the Conclave to the status of Aesthetic Paragon, as well as the generous patronage of the Court of Courts.

In addition to the five finalists’ entries, the top contending works from each of the regional finals will also be on display, making this an unforgettable display of the finest shiftsculpture in the Empire.

– from the Calmiríë Daily Journal

Being Too Clean

Posted by

Lorcis Vianath-ith-Vianne & Selves Pty., Bonded Commercial Obligators, to Mettáre viKoruaz, viKoruaz, viHanic, and Siblings, greetings.

With regard to your communication of the 3rd inst. with our client, Ordene Psychedesign, ICC:

Without prejudice, our client expresses regret at your client’s dissatisfaction with the performance of their product, AnAddiction™.  Nevertheless, we beg to point out that;

Firstly, the product did function as designed.  By your client’s own admission as stated in your communication, the modification of the neural loops of the basal ganglia limbic pathways by the AnAddiction™ nanomachines produced an absence of the psychological addiction to catecholamine rríyek-4/CrystalFugue™ which, as you indicate, was your client’s purpose in purchasing this product.

Secondly, further without prejudice to the validity of the claims that you make regarding the effect of the product, post-usage, upon your client’s personal relationships (p. 2-4 of your complaint) and religious faith (p. 5), our client freely stipulates that, should such behaviors extend to the degree of behavioral addictions in a clinical sense (ref. Manual of Mental Diagnostics, 271st ed., p. 479), the AnAddiction™ product would also remove the limbic pathways promoting such behaviors.

However, we would draw your attention to clause 14 in the purchase contract-waiver, signed by your client before purchasing the AnAddiction™ product, which states that the product should only be used on brains reflecting otherwise healthy/optimal mind-states, in a clinical sense (ref. Manual of Mental Diagnostics, 271st ed., p. 29), for the removal of specific single addictions or general addiction, and in particular to subclause 14(a), which makes specific mention of AnAddiction™’s indistinctive removal of all addiction-promotor loops exceeding the clinically determined indicator level, and refers you for more details to the relevant case studies (Identification of Pathological Promotor Loops in the Sophont Brain, Journal of Neuronanopharmacology, Imp. U. of Almeä Press, v. 517) and the AnAddiction™ clinical trials.  Per clause 14, our client does not recommend and specifically disclaims liability for use of AnAddiction™ on non-healthy/optimal cases except under the supervision of a professional bonded psychedesigner.

As such, we would advise you that our client does not intend to offer a settlement with regard to your proposed suit, and it is our opinion that the claims you cite are meritless under applicable commercial and contract law, and that our client will prevail should this matter proceed to litigation.

Lorcis Tridecimus Vianath-ith-Vianne, obl.

for and on behalf of

Lorcis Vianath-ith-Vianne & Selves Pty., Bonded Commercial Obligators
Ordene Psychedesign, ICC

Trope-a-Day: Cool Airship

Posted by

Cool Airship: Yes, of course.  All the best universes have airships.  For cargo transport that’s cheaper albeit slower than vector-control vehicles, and – for early colonies – not nearly so infrastructure-dependent, but more importantly, for passenger transport that while it may not be as fast as a sub-ballistic dart or a flitter routing, is substantially more civilized for a gentleman or lady of leisure; basically, a flying ocean liner held up by a big bag of vacuum.

G is for Galaxy

Posted by

G is for Galaxy
a whirlpool of stars.
A trillion new worlds
to shape and make ours.

H is for Habitats
our islands in space.
Skyfarms and cities
each orbits in place.

I is for Immortagens
life without end;
captured in a bottle
to give to our friends.

Trope-a-Day: Conveniently Coherent Thoughts

Posted by

Conveniently Coherent Thoughts: Subverted; the reason you can get some coherent thoughts and images through the techlepathy part of the Psychic Powers is because they require you to produce specifically focused thoughts and images in order to engage the transmitter, in a similar way to a voice-activated microphone.

If they just transmitted your regular thoughts as they happened, the telepathic bands would be filled with not merely a rambling narrative thread of consciousness, but pure neural hash from the thousands of different threads in your mind all talking at once.