Truffle House

mycofibrillin was originally a product designed by the space division of Molecular Architecture, ICC, under the Mycofibrillin™ trademark. It was a development of early experiments in creating spaceborne life, such as the regoformer “asteroid lichen”, which sustains itself using solar energy and water extracted from icy regolith.

Unlike its predecessors, mycofibrillin was designed not as an experiment or artwork, but as a functional tool. A designed-from-scratch neogen, it was a reinterpretation of various fungoid lifeforms – which took the form of an intertwined mat of fibers – for the space environment: a recreation of similar reaction networks making use of silicates, silanes, and silicones, at much lower temperatures, relying upon both a trickle of solar energy and provided radio-frequency energy broadcasts to power its metabolism.

The function of mycofibrillin was simply to stabilize aggregate-class “rubble pile” asteroids for relocation, or indeed for other exploitation. A rubble pile infected with a mycofibrillin culture, along with a microwave beacon to feed its growth phase, would swiftly find itself perfused by silicone-sheathed rhizomorphic hyphae of substantial tensile strength, acting to bind the many components of the rubble pile together into a single coherent mass.

Since this promising start, later offshoot technologies have included the thermophilic bionanotech weaves developed in conjunction with the chfsssc for stabilizing tectonically vulnerable regions of planetary crusts along with a variety of refined mycofibrillin derivatives, including a number of strains whose tensile strength is claimed to be suitable for maintaining the stability of large asteroids or small planetesimals when spun up to usable gravity-simulating speeds (although, in practice, the majority of residents of these worlds prefer microgravity environments).

– The Biotechnology of Space: A History, Kynthia Naratyr-ith-Naratyr

Trope-a-Day: Scale of Scientific Sins

Scale of Scientific Sins: All of them.  Absolutely all of them.

Automation: Of just about everything, as exemplified by the sheer number of cornucopia machines, AI managers and scurrying utility spiders.  Unlike most of the people who got this one very badly wrong, however, in this Galaxy, almost no-one is stupid or malicious enough to make the automation sophont or volitional.

Potential Applications: Feh.  Anything worth doing is worth doing FOR SCIENCE!  (Also, with respect to 2.2 in particular, Mundane Utility is often at least half of that point.)

GE and Transhumanism: Transsophontism Is Compulsory; those who fall behind, get left behind.  Or so say all we – carefully engineered – impossibly beautiful genius-level nanocyborg demigods.  (Needless to say, Cybernetics Do Not Eat Your Soul.)

Immortality: Possibly cheating, since the basic immortality of the eldrae and galari is innate – well, now it is, anyway – rather than engineered.  Probably played straight with their idealistic crusade to bring the benefits of Avoiding That Stupid Habit You Have Of Dying to the rest of the Galaxy, though.

Creating Life: Digital sapience, neogens (creatures genetically engineered from scratch, rather than modified from an original), and heck, even arguably uplifts, too.

Cheating Death: The routine use of vector stacks and reinstantiation is exactly this.  Previously, cryostasis, and the entire vaults full of generations of frozen people awaiting reinstantiation such that death would bloody well be not proud.  And no, people don’t Come Back Wrong; they come back pretty much exactly the same way they left.

Usurping God: This one is a little debatable, inasmuch as the Eldraeverse does not include supernatural deities in the first place.  On the other hand, if building your own complete pantheon of machine gods out of a seed AI and your own collective consciousness doesn’t count towards this, what the heck does?

Trope-a-Day: Planet of Hats

(Incidentally, if you were wondering what I was doing this weekend, I was attempting to nail down the characters for my next ongoing longer series. I think I have a good handle on four of them, as of now. The fifth… is troublesome.)

Planet of Hats: Trying very hard to avert this one, except for in-world explicable exceptions like relatively new, low-population colonies, and odd cases like Valiár (Imperial Core), one of the Thirteen Colonies whose colony ship malfunctioned explosively, leading to the planet being populated by large numbers of clones of an original small group of archetypes.  (And even then, they’re not all that hatty.)  And, of course, some created species.

More Reactions

(to these events…)

“By vote of three to one, the Photonic Network abstaining, the Presidium of the Conclave finds no justification in the any of the Accords to disbar any species from signatory status or from signatory-member status on the basis of its origin.  By vote of three to zero, the Photonic Network and League of Meridian abstaining, the Presidium of the Conclave finds that homeworld status under the Common Volumetric Accord is properly granted to the first colonies of the temísi, arthál, and zal!en under the nomadic-species precedent set by the róthich in in re Rothichican.  And neither the Presidium nor the Conclave as a body has any further comment on this affair.  Please refer your questions to individual legations.  Thank you.”

– Peliakos Amvarixin ve-Sintich, spokesman for the Conclave

“‘Playing god?’ is it?  ‘Fake bodies and rootless environment’?  Oh-ho!  I scent the stink of Never Last, Parents for Natural Children, or some others of that baseline-uber-alles, rah-rah crowd upon that so-innocent article sent anonymously to the Router.  All they need is to mention impurifying their essence and we’d have the whole set.  Unless that’s what they meant by that ‘natural species’ emphasis which – speaking as one of the enthusiastically Reengineered Esseli Biosystem – they can shove right up their excretory vacuoles.”

“The soph’s an idiot.  Makes no sense at all.  Fictional government — all governments are fictional until you implement them, and with people like the Iltines and the Galians and the Vonnies out there, they can hardly do worse.  And as for culture, these new species may not have much self-generated culture now, but that’s a problem that will solve itself in just a few decades or centuries spent living.”

“I’d offer to grow him a new exocortex, but this much stupid’s got to be contagious.”

– GTTAAACATATGGAGGCCATACGA, letter to the Accord Journal

“It’s certainly not what we expected when we sold the rights to ith-Vinithinios.  And for myself – when we first heard about it, I thought it was the weirdest damned thing.  Just a game setting, you know, no more than that.  I and my design team just made them and their cultures and all the rest of it up for the sake of the story we wanted to tell.  It never crossed my mind – never crossed any of our minds – that people might actually want to live there.”

“Now?  Well, no offense intended to those involved, but it still seems a little weird.  But mostly, I think we’re proud of having invented peoples, places and cultures that they wanted to make real.  And I very much look forward to seeing what they do with them.”

– Camdal Essenye-ith-Haranye, lead designer, Mirajdíä Studios

“Oh, great.  Nice for them.  But how are we supposed to play the games now?”

– overheard in a skymall, at Asché (Lilium Drifts)

Stranger Than Fiction

Heard of the temísi?  The arthál?  How about the zal!en?

Well, if you had been part of the gaming set between ten and twenty years ago, you did, since these three fictional species made up most of the protagonists of An Ending Not In Fire, the blockbuster virtuality game (and novel, InVid, watchvid, and slinky) franchise from Mirajdíä Studios (Delphys), with its overarching story of love and politics and betrayal and existential threats set in the Greater Ancíël Whirl.

And you’d have heard of them again last week if you read Galactic Demographics Quarterly, since all three of them just turned up in the Empire’s latest statistical update.

This is not merely a repeat of the story some of you may recall seeing a few years ago that Metabiologics, the specialist bioshell manufacturer, had started producing bioshells matching the physical forms of these species for the enjoyment of fans; that was merely another piece of strangeness from our primary source for strangeness, and not something that would appear in the demographics.

Now, however, funded by the “eccentric” quadrillionaire Meris Vinithos-ith-Vinithinios, a consortium of biotechnology companies has produced viable – fully capable of independent life and self-perpetuation – neogen species designed to match those in the game from which they originated.  Millions of sophonts have chosen to adopt these species as their own, and had it formally recognized by their government.  And more, I am informed that Vinithos-ith-Vinithinios’s consortium has acquired the colonization rights to three ecopoesable planets in the Banners constellation, and arranged to have these recognized as the adopted homeworlds of these fictional species, with representation both in the Shadow Ministries’ Convention of Species and as Imperial member polities using their fictional government, barely modified!

If you aren’t terrified yet, you should be.  Here we have the absolute cutting edge of biotechnology, a degree of manipulating nature that should be treated with the utmost respect, being used to… what?  Turn playing storyteller into playing god?  A man with enough money to wave aside the problems of any dozen backward planets you care to name spends it on realizing an elaborate fantasy.  Millions of people abandon their homes, their roots, their own species to live their lives play-acting cultures that some writers made up whole-cloth, and to raise their children in the same fake bodies and rootless environment.

And their government, finding a new low point in its well-known distaste for responsibility, not only doesn’t see fit to raise any questions or take any actions to stop all this, but cheerfully accepts these… defictionalizations as new member species and nations without so much as a sideways look.  One might have hoped that one of the Great Powers of the Worlds, one that sits on the Presidium of the Conclave, even, might act with a little more gravitas and respect for the essence of our galaxy’s natural species, but no.

This is how the wealthy and powerful among people and nations act today.  It’s no wonder the galaxy’s in a hell of a state.

– Independent Worlds Router, anonymously filed article

“They may have picked an unconventional way to go about it, but our new temísi and arthál and zal!en citizen-shareholders are going about building something; worlds, lives, cultures.  That’s their free choice and something laudable, not blameworthy.  If you want someone to blame for the state of the galaxy, try the narrow-minded microcephaloids like whoever submitted that article to the Router.  And yes, that is the official position of this government.”

– Esmérel Amanyr-ith-Loriane, Imperial Palace press secretary